Suggested problems

Biological Motivation

Also Watch your favorite Pinoy Tv Replay,Pinoy Tambayan,Pinoy Teleserye Replay,Pinoyflix,Pinoy Replay,Pinoy Lambingan Also Watch your favorite Pinoy tv Replay,Pinoy Tambayan, https://ofwpinoyteleserye.su/ Pinoy Teleserye Replay,Pinoyflix,Pinoy Replay,Pinoy Lambingan ,

Also Watch your favorite Pinoy Tv Replay,Pinoy Tambayan,Pinoy Teleserye Replay,Pinoyflix,Pinoy Replay,Pinoy Lambingan Pinoy Lambingan at  https://ofwtvreplay.su/ 

Also Watch your favorite Pinoy Tv Replay,Pinoy Tambayan,Pinoy Teleserye Replay,Pinoyflix,Pinoy Replay,Pinoy Lambingan Also Watch your favorite   Replay,Pinoy Tambayan,Pinoy Teleserye Replay,Pinoyflix,Pinoy Replay,Pinoy Lambingan . at https://dramasok.net/

Watch and download Korean drama, movies, Kshow and other Asian dramas with english subtitles online free. Dramacool Videos for everyone   https://kissasiantv.watch/

Watch and download Korean drama, movies, Kshow and other Asian dramas with english subtitles online free. Dramacool Videos for everyone  https://kshow123.watch/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21