Suggested problems

Langtang Valley Trekking

April 21, 2022, 2:15 a.m. by Himalayan Frozen Adventure

Biological Motivation

[Langtang Valley][1] is a major attraction valley in Himalayan Nepal which is rich with natural, cultural, and wide mountain ranges. This Langtang Valley Trek is the most comfortable and easy route than [Everest Base Camp][2] and [Annapurna Base Camp Trek][3].

Langtang Valley route passing through the rhododendron forest of Langtang National Park, the trail along the Langtang River, presents the opportunity to spot extraordinary vegetations, birds, and animals like Danphe (Nepal’s national bird), musk deer, Pika, and monkey.

The Kyanjin Gompa monastery and traditional yak cheese factory in the midst of Langtang Lirung make this trek out stand in the crowd of dozens of other trekking routes.

This [Langtang Valley][4] is cover with the massive glacier and you get to see rare flora and fauna at Langtang National Park, it introduces the Tibetan culture and tradition of the people and the natural beauties of the popular peak of the great Himalayas.

Yala Cheese Factory, Keynjing Gompa –an old Buddhist monastery, and the panoramic view of Mt. Langtang RI, Langsisa, Langtang Himal, Ganjala Peak, and Langtang Lirung glacier from Tsergo RI, are some of the major attractions of this trek. You get an amazing experience of remote trekking trails with amazing scenery.

...

[1]: https://www.himalayanfrozen.com/langtang-valley-trek [2]: https://www.himalayanfrozen.com/everest-base-camp-trek [3]: https://www.himalayanfrozen.com/annapurna-base-camp-trek [4]: https://www.himalayanfrozen.com/langtang-valley-trek

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21