Suggested problems

How Do The New UK Vaping Laws Affect E-Liquids?

April 20, 2022, 7:49 a.m. by ryanazim

Biological Motivation

Different countries in the world have completely banned the consumption of vaping for different reasons. One of the main reasons behind this ban is the use of illegal and toxic products such as marijuana and barbiturate.

However, in England, vaping is considered permissible under some regulations, and a person who does not adhere to these regulations will have to bear the serious consequences. Laws are made for the protection of people in society. As a part of this society, it is your responsibility to strictly adhere to the laws provided to you by your government. Vape as the Most Effective Alternative to Smoking: Vapes are used as an effective alternative to smoking in England over the past few years. Various health organisations such as Public Health England, Royal College of physicians and Cancer Research UK have declared vapes less harmful than cigarettes.

Thousands of people in England have successfully abandoned their smoking habits with the help of vape devices. Vaping is undoubtedly permissible in England, but one cannot vape if they are not acquainted with the basic vaping rules. These rules are set by the TPD (Tobacco Productive Additive) and according to the rules:

● The size of e-liquid bottles should not exceed 10ml. ● In average vape juice, the strength of nicotine should not be more than 20mg/ml. ● Warning labels should be there on the e-liquid bottles. ● The packaging of e-liquid bottles should be child and tamper-proof. ● The tank holding capacity of e-liquids shouldn’t be more than 2 ml. ● Thorough testing of e-liquid ingredients.

After these laws, the sale and purchase of vape juices become easier. Besides, one cannot purchase any harmful substance in vape juices, which shows that these laws have positively impacted vaping. E-liquid Ingredients:

E-liquids like Signature e-liquid and Dinner lady e-liquid are the vital components of any vape device, and without them, a vape cannot function properly. But what exactly e-liquids are, and why they are so important?. A vape is a battery-powered device that heats e-liquid and turns them into a vapour. The four basic ingredients that are required to make e-liquids include:

● Propylene glycol ● Vegetable glycerine ● Nicotine ● Flavourings

Propylene Glycol: Propylene glycol is a thin, odourless and tasteless liquid that is mostly used as a food additive. Also, many cosmetics and medical industries utilise PG in their products. PG is substantially important in e-liquids. It carries the e-liquid flavour more adequately. Besides, it gives a strong throat hit that simulates the sensation, similar to cigarette smoking.

Vegetable Glycerine: On the other hand, Vegetable glycerine is used to produce big clouds of vapours. VG is slightly sweeter than PG and is used in many pharmaceutical, cosmetics and food product industries. Vegetable glycerine is toxicant free as it is derived from vegetable oils. VG in e-liquids gives vapers a smooth throat hit and good quality vapours.

Best e-liquids contain an equal amount of PG/VG ratio for a better vaping experience. I-e., 50 VG / , 50 / PG.

E-liquid Flavours: E-liquid contains flavours that are non-toxic and less harmful. The ambrosial e-liquid flavours give your vaping an incredible experience. There are a number of e-liquid flavours available in the market. However, make sure you choose a flavour that best fits your needs.

Nicotine: Nicotine arrives in your brain; within 10 seconds of your first puff, and when it arrives in your brain, it leaves toxicant chemicals that affect your brain’s functioning. Since nicotine in vapes is lab processed, it has less health effects on your brain. Besides, vape juices contain nicotine in various strengths, varying from person to person.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21