April 19, 2022, 5 a.m. by Ellena joshi
Biological Motivation
AT&T Yahoo is a user-friendly mailing platform that is preferred by millions of users across the globe. Yahoo email inside AT&T has many features but sometimes, users may face ATT mail Login issues. To rectify the situation, you can contact professionals to fix the issues. You can reach us immediately for top solutions via the AT&T Yahoo email customer service number.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
