Suggested problems

Did Hitler Invent the human sexdoll?

April 18, 2022, 12:45 a.m. by GLOBALDOLL

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

End of July 2020, readers shared an article from 2016 that had the headline, “Did Adolf Hitler Really Invent the human sexdoll?” Many readers were interested in finding out whether Hitler in fact invented the Adult sex doll. The article did not actually state this. The article was posted at The 13th Floor, an horror-genre blog that focuses on creepy and macabre stories. “The Borghild Project, (allegedly), was an ultra-secret attempt by Nazi soldiers to stop the spreads of syphilis. They provided them with human sexdoll. Hitler invented the blow up doll! However, the writer acknowledged that the Borghild Project had been a fraud. The idea that Hitler invented the human sexdoll is so incredible, we should pretend it ever happened. “I mean, Hitler will do what Hitler did about it, right?” We sent an inquiry to the museum that chronicles the history medicine and received no response. We’ll update this post if we receive any response. Laurie Marhoefer of Washington University, an associate professor of historiography, said in an email that it was a hoax based on “very realistic concerns [Heinrich] Himmler expressing about German men (especially SS soldiers) being able sex freely and also the syphilis control measures that were taken by the Nazi State, such as regulated prostitutes. Many governments in the time had similar practices. But, human sexdoll are a hoax. Elizabeth Heineman from the University of Iowa, who is also a professor of history, told us there is no evidence that lifelike sex dolls were made during World War II. Heineman explained to us by email, “The [erotica] consumers were overwhelmingly veterans, with the industry having an astonishingly wide variety of products on hand.” “Sometimes the catalogues for such items were over 150 pages by mid-1950s,” she noted, but those pages did not contain human sexdoll. Heineman explained, “It’s not easy to imagine that furry sex dolls had ever existed — if people had memories of them — or if there were rumors and they wanted to see one now that they’d been back to civilian life — but they wouldn’t appear in the erotica books of 1950s.” She added that “that doesn’t prove they weren’t there during the war.” It’s just to let you know that they aren’t showing up in the place one would expect. However, we do not believe Hitler invented the human sexdoll. This claim is therefore considered “False.”

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21