Suggested problems

Biological Motivation

Worried about the Budget? Don’t worry about the budget as we offer the most affordable Balloon Decorations services to make your day special with the most beautiful and classy Birthday Balloon Decorations. From budget friendly to premium we have all type of Decorations [balloon decors near me][1] available . Visit our website to know more about information’s. ...

[1]: https://www.7eventzz.com/chennai

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21