July 29, 2015, 1:03 a.m. by Rosalind Team
There are three different ways to divide a DNA string into codons for translation, one starting at each of the first three starting positions of the string. These different ways of dividing a DNA string into codons are called reading frames. Since DNA is double-stranded, a genome has six reading frames (three on each strand), as shown in Figure 1.
We say that a DNA string Pattern encodes an amino acid string Peptide if the RNA string transcribed from either Pattern or its reverse complement Pattern translates into Peptide.
Find substrings of a genome encoding a given amino acid sequence.
Given: A DNA string Text and an amino acid string Peptide.
Return: All substrings of Text encoding Peptide (if any such substrings exist).
ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA MA
ATGGCC GGCCAT ATGGCC
Note