A file in FASTA format (.fas, .fasta) applies the following sample notation to store genetic strings:
>Taxon1 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG >Taxon2 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT ATATCCATTTGTCAGCAGACACGC >Taxon3 CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC TGGGAACCTGCGGGCAGTAGGTGGAAT
Every string in a FASTA file begins with a single-line that contains the symbol '>' along with some labeling information about the string. The word following the '>' symbol is the identifier of the sequence, and the rest of the line is its description (both are optional). There should be no space between the ">" and the first letter of the identifier.
All subsequent lines contain the string itself; it is recommended that all lines of text are shorter than 80 symbols. The string ends when another line starting with '>' appears, indicating the start of another sequence (or if the end of the file is reached).
