Suggested problems

SEO Service company in California

Oct. 14, 2019, 10:56 a.m. by Danny369

Biological Motivation

SEO stands for [search engine optimization] it is a back born for the all type of on-line business, every big organization well know about the role of SEO in this digital world, SEO plays a major role to get the traffic for every type of website. seo is a set of rules for optimizing your website so that it can achieve higher rankings in search engines organic results. it helps in making the web site user-friendly. Ca Seo company » is an SEO agency that provides SEO service in California, they are [California SEO expert][1] and one one of the best SEO company in California its SEO service popular in California. they are California SEO expert

In this digital competitive market, SEO marketing is a lot of necessary than ever. If you have a web website, weblog or online store, SEO will assist you to get targeted free traffic from search engines. ca SEO company California is a well-known agency that specializes in digital advertising solutions. they have experience working with a variety of business sectors including aviation, construction, real estate, technology, lifestyle & leisure, government, healthcare, non-profit, and hospitality. They also offer extra services like social media management and web design. you must contact the California SEO expert they will help you in a simple way. they provide the best SEO service.

[1]: https://caseocompany.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21