Suggested problems

Google Pay Customer Service Number

Oct. 7, 2019, 10:28 a.m. by LindaJo22548782

Biological Motivation

Google is known by everyone in the world. Google pay (Tez) is a online payment service launched by Google. Google pay was released in August 2017 two years ago. Most of the times many people use it to do their online money transactions activities and instantly they get solutions, Google Play is giving so many apps and guys are using it. Google Play keeps on launching apps but one of them Pay app is making online transactions & transferring money to someone in an easy way while using safe and secure transactions and Google Pay Customer Executive gives you solutions if we have any kind issue regarding Google Pay app. Google Pay Customer Service Number +1-833-260-7367 or you can visit on Website https://www.onesearchpoint.com/googlepay-customer-service#

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21