Suggested problems

AOL customer service number

Oct. 1, 2019, 10:49 p.m. by marrymartin

Biological Motivation

AOL Desktop Gold issues can occur at any time. It does not wait for a convenient moment for the user when concerned can get the best technical support. One must be able to obtain all-round support to solve the problems associated with this desktop software. [AOL customer service number][1] expert usually fulfills and must complete a set of responsibilities to achieve maximum customer satisfaction.Retaining customers can become a challenging situation in today's fast pacing world. There are so many customer support helplines open that it has become a completely competitive scenario. Building and providing an excellent customer experience is important when it comes to delivering vast arrays of technical support. You can also visit our website http://webslivesupport.com/aol-customer-service-number/

...

[1]: http://webslivesupport.com/aol-customer-service-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21