Suggested problems

How to Search Low Fare Airlines by Google Flights Search

Sept. 12, 2019, 9:11 a.m. by Johnny Deep

Biological Motivation

Google flights are the best travel agency and provide the best services for booking cheap flights and hotels for all domestic and international destinations. By [Google flights search][1] portal entering your departure or arrival entries click on calendar right-hand site where you will see discount offers prices and now choose your package and book flights and save till 50% money. For more information or query visit the site.

[1]: http://%20https://www.deltaairlinesreservations.flights/google-flights/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21