Suggested problems

AOL desktop gold Keeps Crashing

Sept. 9, 2019, 7:16 a.m. by Micheal Henderson

Biological Motivation

AOL gold software may start crashing when you have upgraded your OS to Windows 10. So now you need to fix it and do so follow these steps: • You can try to update AOL desktop gold to the latest version and install all the updates. • Then you can remove any bugs by scanning your computer. • Try to check firewall or other third-party software if they are interrupting AOL desktop gold and you can disable these programs for a while. • Next, close down all the running programs and restart your system to fix the issue. If you still can not fix the issue, then you will need to [download gold AOL][1] again to your system and then you can start afresh without any issue.

...

[1]: https://www.onlinedesktopgold.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21