Suggested problems

Side Effects of Anabolic Steroids on Muscle - The Rehab Treatment

Sept. 6, 2019, 10:17 a.m. by oliver harry

Biological Motivation

Anabolic steroids are artificial, or human-made, variations of the male steroid androgen. the right term for these compounds is anabolic-androgenic steroids.

Side Effects of Anabolic Steroids on Muscle Anabolic steroids work otherwise from alternative medicine of abuse; they are doing not have similar short-run effects on the brain. the foremost necessary distinction is that steroids don't directly activate the reward system to cause a “high”; they conjointly don't trigger fast will increase within the brain chemical Intropin, which reinforces most alternative forms of drug-taking behavior.

Even though anabolic steroids don't cause a similar high as alternative medicine, they will result in a substance use disorder. A substance use disorder happens once an individual continues to misuse steroids, even supposing there are serious consequences for doing this. the foremost severe variety of a substance use disorder is an addiction. individuals may still misuse steroids despite physical issues, high prices to shop for the medicine, and negative effects on their relationships. These behaviors mirror the steroids' habit-forming potential. analysis has more found that some steroid users address alternative medicine, like opioids, to cut back sleep issues and irritability caused by steroids. https://therehabtreatment.com/anabolic-steroids-effects-on-muscle/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21