Suggested problems

QUICKBOOKS ONLINE SUPPORT

Aug. 22, 2019, 12:57 p.m. by mohdjabir

Biological Motivation

QuickBooks is an accounting software package developed and marketed by Intuit. QuickBooks products are geared mainly toward small and medium-sized businesses and offer on-premises accounting applications as well as cloud-based versions that accept business payments, manage and pay bills, and payroll functions. Please Contact to [Quickbooks customer service number][1] Help Team.

https://www.primeaxle.com/quickbooks-support/

[1]: https://www.accountwizy.com/quickbooks-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21