Suggested problems

Dilaudid Drugs Addiction and Its Side Effects

Aug. 22, 2019, 7:14 a.m. by RON JR

Biological Motivation

https://therehabtreatment.com/dilaudid-drugs-addiction-side-effects/"> Dilaudid Drugs Addiction and Its Side Effects

Dilaudid may be a prescription medication wont to alleviate moderate to severe pain caused by cancer, broken bones, major surgeries or alternative medical conditions that involve chronic pain. additionally, called analgesic, this drug is an element of a category of gear referred to as opioids that alter the brain responds to pain and ease discomfort. Analgesic was created as another to alternative pain relievers that were thought to hold fewer negative facet effects and health risks.

Dilaudid is prescribed to assist relieve pain and discomfort. However, it’s vital to stay in mind that hydrophone hydrochloride isn’t prescribed to each patient United Nations agency has to manage pain. Some doctors impose hydrophone hydrochloride for chronic pain, whereas others could suggest totally different medications. The explanation that hydrophone Hydrochloride is run varies in every individual case. Thanks to the strength and habit-forming nature of this drug, it's solely distributed in specific circumstances. hydromorphone hydrochloride may be a terribly potent medicine medication wont to treat varying levels of pain.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21