Suggested problems

24*7 Available CenturyLink Customer Service

Aug. 10, 2019, 10:38 a.m. by Jonas Hal

Biological Motivation

[CenturyLink Customer Service][1] has a team of skillful specialist who is often out there to provide support to its customers with any issues. The technicians are present who are well trained and can guide you with proper directions. For any problems or problem, you'll call CenturyLink Contact service on their number. the quantity is on the market 24*7 for the customers to get support in any department of the services. CenturyLink Contact number is gift to assist the customers in each possible approach. the customers will have a direct chat with the specialist to have fast solutions. you may have to decision the team on the fee number and talk to CenturyLink Contact number. the most goal of the organisation is to finish the requirements of the users. If it isn't there, then there is also an error which could become rampant the total life on the earth. CenturyLink, Inc. is that the technology company that's functioning within the field of telecommunication, security, cloud computing, voice, and managed services to customer worldwide. they are one in each of the most effective in there. However, there is also issues that the user may face. If you are one in each of these, then avoid them with the help of CenturyLink customer Service. Once you get to bear with them, you'll be able to get the solution to the matter you are facing ASAP. This is the sign for any queries directly associated with accounts and request. confine mind that this could be utterly totally different from the figure payments. If you'd want to pay your bill over the phone or modification your current payment technique, you need to instead call the number listed beneath payment specialists. With these few queries, if you tackle the other problems, you'll quickly get wise resolved by talking to CenturyLink Contact number on their fee number. The team has skillful members who can offer you the required solutions and step-by-step a procedure as well. From choosing a theme till enjoying the services, for any problem, you'll contact CenturyLink customer Service and know the answers. The team is often gift for you. The team is there to help the customers at each step of the service and works for the profit of the users.

...

[1]: https://helpsupportservice.com/customer-service/centurylink-customer-service/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21