Suggested problems

Amazing formal dinner wear for ladies

Aug. 9, 2019, 10:17 a.m. by adrieljones

Biological Motivation

Lot’s of [amazing formal dinner wear for ladies][1] are available for ladies in the market. When you’ve planned to move to a dinner party during that dress-up yourself with some formal descent clothe and tie with it which absolutely fabulous look. You can choose dresses as per your choice but make sure that must not be too heavy.

[1]: http://www.acvariu.ro/forum/user/profile/15623.page

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21