Suggested problems

Zelle Customer Support Number +1(855)-504-2278

Aug. 6, 2019, 4:53 a.m. by devidelise00

Biological Motivation

If your Zelle account occupied with endless technical errors. Do you need to get rid of such errors as soon as possible and looking or easily reached ways to deal with such queries? If you are unable to tackle such errors, you can get in touch with the OPT Customer service who are active 24 hours a day or night. Dial Zelle Customer Support Number +1(855)-504-2278 which is always approachable.

https://www.optcustomerservice.com/zelle-support-number.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21