Suggested problems

Zelle Support Service

Aug. 1, 2019, 5:27 a.m. by Cashapp

Biological Motivation

Tell us the issue regarding Zelle account. contact Our third-party Zelle professionals or technicians if you want to eliminate or resolve your all Zelle related issues. [Zelle Support Number][1] +1(855)-504-2278

[https://www.optcustomerservice.com/zelle-support-number.html][2]

[1]: https://www.optcustomerservice.com/zelle-support-number.html [2]: https://www.optcustomerservice.com/zelle-support-number.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21