Suggested problems

What to do if the HP Printer keeps turning off?

July 5, 2019, 7:03 a.m. by Henry Taylor

Biological Motivation

When the HP Printer turns off unexpectedly, it will not respond to any printer jobs or commands. You can refer to the suggestions given below to HP Printer turning off unexpectedly: • Change the energy settings and check the ‘Auto Power Off’ feature. • Restart your HP Printer to fix minor connectivity errors. • Visit the official HP website and update your HP Printer firmware. • Reconnect the power cable and plug the printer directly into the power outlet • Try replacing the power module on your HP Printer to make sure the power supply is steady. If you need help implementing the steps mentioned above, you can always call the [HP Printer customer service number][1] and ask for additional technical assistance.

Read more : [Scan Documents HP Printer][2]

[1]: https://www.fixdevicehealth.com/hp-printer-support/ [2]: https://www.fixdevicehealth.com/blog/how-to-scan-a-document-on-an-hp-printer/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21