Suggested problems

Cash App Support Number

July 3, 2019, 9:46 a.m. by Cashapp

Biological Motivation

Have you needed to contact Cash App about an issue you're having? Cash App doesn't have any address dedicated to providing customer support. We give you the best [Cash App customer support.][1] Visit here Help Center. +1-855-504-2121

[https://www.optcustomerservice.com/cashapp-support-number.html][1]

[1]: https://www.optcustomerservice.com/cashapp-support-number.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21