Suggested problems

Exterminator bug services

June 26, 2019, 10:54 a.m. by John Thomas

Biological Motivation

Firstly we investigate your home thoroughly for developing the plan that gives you the best protection from the bug. [Exterminator bug services][1] are one of the most effective agencies in your area to get rid of Bed bugs. Pests can be the reason for a lot of health issues. Pests can also damage your home and destroy them completely. Once your home gets invaded with pests, in no time they can spread out to a large area as they multiply very fast. Thus it is always a good idea to get professional pest control done at the right time before these creepy insects can cause severe damage and great losses. So, let's discuss how many types of pest treatment.

TYPES OF PEST TREATMENT Pest Control for Ants Pest Control for cockroaches Pest Control in Kitchen Residential Pest Control Commercial Pest Control AMC For Residential Pest Control Service AMC For Commercial Pest Control Service

[1]: https://exterminatorbugservices.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21