Suggested problems

Independent Escorts Services

June 18, 2019, 2:19 p.m. by kiaescorts

Biological Motivation

Independent Escorts Services in Jaipur, Escorts Agency for conventional and tasteful noblemen. I am an extremely lovely reasonable tall and attractive woman, I am enchanting pretty and youthful charming female dating fraternity for noblemen and agents and low maintenance serve who are in the scan for consummate better than average escorts young ladies in Jaipur. On the off chance that you are going to adjacent worldwide Airport and residential air terminal Jaipur Rajasthan then I can control you renowned and authentic place and points of interest.

Partner, the only companion in your life who come to you, hold your hand and do all the craziest things which you always want to done and need a company who will also do the same things in the way you always wanted. There are many different.

link :- http://www.kiaescorts.com/independent-escorts

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21