Suggested problems

Which is best taxi service in Dehradun?

June 16, 2019, 7:07 a.m. by Kuldeep Karki

Biological Motivation

If you are planning to Visit Hill Stations in these summers and looking for a reliable Taxi Service in Uttarakhand to plan your Trip. Then we are here to provide you best [taxi service in dehradun][1] and we are here to make your Trip more comfortable and safe with our best quality [Cab Service in Dehradun][2] and all other parts of Uttarakhand.

We provide Taxi Service for Mussoorie, Jolly Grant Airport, Local Taxi Service in Dehradun, Cab Service in Dehradun, Dehradun to Haridwar Taxi, Delhi to Haridwar Taxi, [Dehradun to Delhi Drop][3], Garhwal Taxi Service Dehradun, Uttarakhand Taxi Service, Rishikesh to Delhi Taxi, Dehradun to Airport Taxi, Jolly Grant Airport to Haridwar Taxi, [Outstation Taxi][4], Delhi to Dehradun Taxi, Taxi Booking in Dehradun and Car on Rent in Dehradun.

We offers many flexible choices when it comes to [hire taxi in dehradun][5] that will suit your needs and preferences best. We offer anything from sedans to hatchbacks to Tempo travellers, which are suited for large parties. The pricing of the various cabs and services is transparent and has no hidden costs to surprise you.

[1]: http://pegioncocktravels.com/ [2]: http://pegioncocktravels.com/ [3]: http://pegioncocktravels.com/ [4]: http://pegioncocktravels.com/ [5]: http://pegioncocktravels.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21