Suggested problems

How to fix AOL Gold Flash Player problems?

June 10, 2019, 7:05 a.m. by Micheal Henderson

Biological Motivation

If you find that videos or games are taking time to load on AOL Desktop Gold, then it is probably because of some error related to the Flash Player. You can refer to the steps below to update Adobe Flash Player on AOL Desktop Gold: • Step 1: Go to the Adobe Flash Player install page • Step 2: Choose your OS and selectFlash Player31 for Opera and Chromium • Step 3: Click ‘Download Now’ and save the Adobe Flash Player update file. • Step 4: Open the file and complete the prompts to update Adobe Flash Player. If still encounter errors while viewing multimedia content on AOL Desktop Gold, you should [download and install AOL gold][1] once again and check if the Flash Player problem persists.

[1]: https://www.onlinedesktopgold.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21