Suggested problems

Amazon Prime phone number

June 7, 2019, 9:54 a.m. by harry jack

Biological Motivation

Amazon prime is a paid subscription service that is offered by One of the largest e-commerce websites Amazon, Amazon prime is used by people all around the world. The reason behind it Amazon prime provides various services to its users such as -free one-day delivery, Amazon family offers, stream music, videos, and other benefits, They also offer different offers and deals for the customers to attract them to not to go to any other website.

https://amazonprimecustomerservice.net/''>Amazon Prime Phone Number is featured in its store, offers to its users, Amazon prime offers the best customer service too. customer problems are all solved at no cost at all, Amazon prime desk is always there to help you whenever you feel stuck at any problem. There are many experts to help you at the desk of Amazon prime customer service.you can talk to the team full of experts to help you solve your issues. Amazon prime provide support via phone, email and chat 24/7.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21