Suggested problems

How to fix HP Printer error oxc4eb827f?

June 7, 2019, 7:07 a.m. by Henry Taylor

Biological Motivation

HP Printer Error Code oxc4eb827f is a printing error related to the printer cartridge or the printhead on your HP Printer. You can follow the steps given below to reset the printer and fix Error Code oxc4eb827f: • Step 1: Leave the HP printer ON and remove the ink cartridges. • Step 2: Unplug the power cord from behind the printer. • Step 3: Turn off the wireless router and wait of about one minute. • Step 4: Plug the power cord back into the printer and install the cartridges. • Step 5: Switch on the computer and the router on and print a test document. If you find that Error Code oxc4eb827f persist even after you complete a printer reset you can call the [HP Printer troubleshooting support][1] and ask for additional technical assistance.

[1]: https://www.fixdevicehealth.com/hp-printer-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21