Suggested problems

Is Programming help necessary for writing Programming Assignments

June 4, 2019, 9:41 a.m. by Johnalexa

Biological Motivation

Hi, My name is john and i am expert in programming and expert in creating assignment. The world of programming is continue changing, new technology is present day by day. Example a few year ago time was server side technology but now this time for client side technology. In this case you have to update continue and need [Programming Help][1] online to solve programming problem. We are here 24*7 for your Programming Assignment Help

[1]: https://www.greatassignmenthelp.com/programming-assignment-help

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21