Suggested problems

how to predict splice junctions using spliceVec

May 27, 2019, 3:13 p.m. by Jenib@bari

Biological Motivation

I am a beginner in bioinformatics and basically from Computer science background.I tried simple examples such as counting number of A G T C from a DNA stand. I have read an article on

SpliceVec:distributed feature representation for splice junction prediction

In this article, the predict splice junctions using doc2Vec and word2Vec model.

I tried to perform the operation but stuck. I have installed gensim library of python but can not understand from where I should begin.

please help!!!

Regards

Jenib Firdousi

India

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21