Suggested problems

How to solve HP printhead missing issue?

May 17, 2019, 9:55 a.m. by Henry Taylor

Biological Motivation

If you see a ‘Missing or Failed Printhead’ error displayed on your HP printer you can follow the steps below to update the firmware and resolve the issue: • Step 1: Open the home screen on the printer control panel • Step 2: Click the ePrint icon and let the printer connect to the ePrint server • Step 3: Tap the ‘Settings’ option on the bottom left corner of the display • Step 4: Click ‘Printer Update’ and then select ‘Check for Update Now.’ If you are unable to update the firmware on your HP Printer, you can call the [HP printer phone number][1] and ask for additional technical assistance.

...

[1]: https://www.fixdevicehealth.com/hp-printer-support/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21