Suggested problems

Gmail not receiving email

Sept. 23, 2021, 10:49 a.m. by marieorpos

Biological Motivation

When your email stops working or gets hacked, don’t panic. Call Email Support Phone Number and let the highly skilled Specialists get you up running. Troubleshooting steps you can try to fix basic email problems: 1: Make sure you’re connected to the web. 2: Close the app, then reopen it. 3: Sign out, then sign back in. 4: Clearing the cookies and history of browser 5: Check your browser extensions or applications and remove unwanted extensions

https://mail-help-number.com/gmail-not-receiving-email/">Gmail not receiving email

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21