Suggested problems

How Do I Get My Money Back From Cash App To Your Wallet?

Sept. 21, 2021, 5:33 a.m. by alicebailey

Biological Motivation

Do you want to be acquainted with [How Do I Get My Money Back From Cash App?][1] For that, you have to simply apply for a refund through which you will be able to get your money back within the least time frame, even in a hassle-free manner. https://www.cashapphelps.info/blog/how-do-i-get-my-money-back-from-cash-app/

[1]: https://www.cashapphelps.info/blog/how-do-i-get-my-money-back-from-cash-app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21