Suggested problems

How To Check My Chime Balance If Facing Any Issue For The First Time?

Sept. 20, 2021, 9:02 a.m. by Kim kardasia

Biological Motivation

As a novice user, you might face some sorts of problems and hurdles while accessing your Chime account. In such a case, you should simply contact the Chime experts without wasting your time. Don’t worry if you are not acquainted with the right process to know [How To Check My Chime Balance][1]?

[1]: https://www.primotechy.com/blog/how-do-i-check-my-chime-balance-on-my-phone/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21