Suggested problems

Cash app customer service facility-get solution right now:

Sept. 20, 2021, 9 a.m. by Kim kardasia

Biological Motivation

Getting a solution for the cash app account might not be an easy task. But the availability of the [Cash app customer service][1] facility has changed the perception in terms of managing the entire cash app management system. People using the cash app can ask the solution services from the deployed service team to avail of the right mentorship and get rid of unexpected issues.

[1]: https://www.cash-apphelps.net/cash-app-customer-service/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21