Suggested problems

komarla brigade residency

Sept. 20, 2021, 7:11 a.m. by Brigade Komarla Heights

Biological Motivation

[Brigade Komarla Heights][1] arising project in pristine locales of South Bangalore in Padmanabhanagar, just off Uttarahalli highway surrounded by all essential social and civic amenities [Apartments in Bangalore][2] . Brigade Groups is that the most-established real-estate brands of India with well- built reputation of building positive housing experience in major cities of India that has Bangalore, Mysore, Chennai, Hyderabad, Kochi and Ahmedabad. the company was founded in year 1986 by M R Jaishankar. The firm is head- quartered in Bangalore with branch offices in several cities of South India and a representative office at Dubai. the company has quite three decades of experience in property-development domain and has immense expertise in various related and non-related portfolios of real-estate that covers commercial, residential, property management services, hospitality and education among others.The project offers one among the simplest belvedere for investments and for end-usage with most perfect location advantage alongside the acquaintance of a reputable brand like [Brigade][3].The apartments are beautifully planned and conceptualised to supply better of urban designs including august ventilation of bright day light and fresh air. The project is all ready to be launched soon with suitable clearances and approvals from relevant departments and is shaping up to become Bangalore’s most sought-for housing destinations. [Brigade’s][4] residential projects include large townships, smart integrated communities, SEZs, customised homes, independent living for senior citizens, villa townships, premium residences, villaments communities, value homes and mixed use lifestyle layouts & townships to name a few.

[1]: https://www.brigadekomarlaheights.org.in/ [2]: https://bandcamp.com/brigadekomarlaheights01 [3]: https://confengine.com/user/brigadekomarla-heights [4]: https://profile.hatena.ne.jp/Brigadekomaralaheights01/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21