Suggested problems

Can I get programming assignment help online?

Sept. 18, 2021, 7:10 a.m. by David Wayne

Biological Motivation

Many [assignment help][1] websites offer programming assignment help as well. They have screened and vetted programmers who have the desired skills and experience required by the students. Their expertise in the subject and years of industrial experience help them solve problems quickly without any trouble. Even if you have a strict deadline to follow, they will make sure that your assignment is completed within the deadline with utmost perfection. Search for programming assignment help and speak to the professionals before you hire anyone.
Read more: https://www.doassignmenthelp.com/ Thank You!

[1]: https://www.doassignmenthelp.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21