Suggested problems

Activate Your Hulu With Code

May 7, 2019, 10:33 p.m. by Robinshri

Biological Motivation

Hulu provides the simplest way to stream entertainment to your TV. On your terms. With thousands of available channels. We provide information regarding Hulu Activation Code. Go to [hulu.com/activate][1], and enter the Activation Code

[hulu activate][2] [www.hulu.com/activate with code][3] [www.hulu.com/activate roku][4] [www.hulu.com/activate][5]

[1]: https://activatehulu.com/ [2]: https://activatehulu.com/ [3]: https://activatehulu.com/ [4]: https://activatehulu.com/ [5]: https://activatehulu.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21