Suggested problems

Lumion Pro Crack

Sept. 17, 2021, 3:34 a.m. by Usman Hayat

Biological Motivation

[Lumion Pro Crack][1] Lumion Pro Crack adds a little flavor when conveying the development of users through a scene plan or a business building. [vMix Pro Crack][2] vMix Crack Software is a video mixing and switching software that takes advantage of the latest features in hardware to enable live HD video mixing...

[1]: https://miraclecrack.com/lumion-pro-crack/ [2]: https://cracksuite.com/vmix-pro-crack-download/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21