Suggested problems

Free Software for Download

Sept. 17, 2021, 3:33 a.m. by Usman Hayat

Biological Motivation

[Lumion Pro Crack][1] Lumion Pro Crack adds a little flavor when conveying the development of users through a scene plan or a business building. Architects love utilizing Lumion for one significant explanation — it revives delivering. Regardless of whether for plan improvement or the enormous customer show, Lumion keeps on upgrading the delivering interaction by bringing draftsmen and the specialty of delivering much nearer together.

[vMix Pro Crack][2]

vMix Crack Software is a video mixing and switching software that takes advantage of the latest features in hardware to enable live HD video mixing. Moreover, a task previously only possible on dedicated and expensive hardware mixers. In addition, This software is an entire stay video manufacturing software program answer with capabilities inclusive of LIVE blending, switching, recording, and LIVE streaming of SD, complete HD, and 4K video assets inclusive of cameras, video files, DVDs, images, Powerpoint, and plenty lots more. ...

[1]: https://miraclecrack.com/lumion-pro-crack/ [2]: https://cracksuite.com/vmix-pro-crack-download/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21