Suggested problems

VIP Escort in Greater Kailash Escorts

Sept. 14, 2021, 10:17 a.m. by akku

Biological Motivation

Most of us are obsessed with the beauty of hot Russian girls, and it is a dream of many Indians to have sexual intercourse with them. What if we say that your dreams will turn into reality soon, you can reach us at Delhi Mahipalpur Escort and see the collection of Greater Kailash Escorts. Our girls are ready to do everything that will make you happy. ![enter image description here][1]

[1]: https://in.admyurl.com/upload_image/605c9b0ddd7faf2021021541-ImageName.jpg

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21