Suggested problems

Speedy Grade

Sept. 9, 2021, 8:50 a.m. by kimberlykeller

Biological Motivation

Gain better scores in every assignment and exam with [Solution Manual For Starting Out With Visual C 2012 3 E 3rd Edition][1]. Be on the top of your class.

[1]: https://speedygrade.com/p/solution-manual-for-starting-out-with-visual-c-2012-3-e-3rd-edition/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21