Suggested problems

best email marketing tool - wphostingmag

Sept. 6, 2021, 9:09 a.m. by wphostingmag

Biological Motivation

Creating a strong email marketing strategy helps you reach and connect with your target audience in a personalized way and increase sales at an affordable cost. Just as other platforms and media have changed, email marketing tools give your business the ability to reach customers easier than ever. Wp Hosting Mag provides the best guidance available online. url: https://wphostingmag.com/top-email-marketing-tools/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21