Suggested problems

BEST SERVICES FOR DRIVERS LICENSE ONLINE

Sept. 5, 2021, 1 a.m. by andersonlarry597

Biological Motivation

BEST SERVICES FOR DRIVERS LICENSE ONLINE Whether you're a youngster just starting your driving journey and on your path to getting your first vehicle, or you're an older person who never required a driver's license until now, the process is easy and smooth with our driver's license online [services][1]. you can get behind the wheel and learn how to drive, you'll need to apply for your provisional driving license online. Are wondering about the significance of a driving license?

[https://expressdrivinglicence.com/contact/
https://expressdrivinglicence.com/buy-genuine-drivers-licence-uk/ https://expressdrivinglicence.com/how-much-does-a-drivers-license-cost/
https://expressdrivinglicence.com/how-to-get-drivers-licence-in-uk/
https://expressdrivinglicence.com/best-services-for-drivers/
https://expressdrivinglicence.com/renew-drivers-licence-online/][1]][1]

[1]: https://expressdrivinglicence.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21