Suggested problems

How To Make Adult fanclub app development?

Sept. 4, 2021, 11:14 a.m. by michalewilliam

Biological Motivation

The entertainment industry is the most stress-relieving platform that people rely on during tough times and also for everyday fun. Hence, getting into the [adult Fanclub subscription app][1] can never go wrong. It is high time to get your business on track with the current trend. We at TurnkeyTown offer the utmost support throughout the whole development process and help you leverage your business by deploying a tailor-made OnlyFans clone.

[1]: https://www.turnkeytown.com/onlyfans-clone-script

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21