Suggested problems

Buy lives at low prices for a limited time

Sept. 2, 2021, 10:25 a.m. by manelnunez875

Biological Motivation

I don't know very well how but I have discovered a website where you can buy lives and coins in different app games both mobile and computer. An extremely cheap resource generator that I don't know how long the promotions will last but take advantage of the opportunity. On the website https://www.forcozylovers.com/es/garena-free-fire you can research the top games of the moment. If you decide to go ahead and buy lives, let me know what your experience was like, I will let you know that mine was really satisfactory.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21