Suggested problems

Now Make Your Account Robust Through Cash App Phone Number

Sept. 2, 2021, 6:43 a.m. by kimberlyscott

Biological Motivation

You want to have an utmost level of security for your Cash App account and [Cash App Phone Number][1] is the main source that can provide you invincible security to safeguard your Cash App account. What you have to do is to be with a team of techies who are capable of exterminating all possibilities of threats in no time.

[1]: https://www.contactsupport-number.net/cash-app-customer-service-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21