Suggested problems

Understand The Entire Scenario About How Long Does Cash App Take To Respond

Sept. 2, 2021, 6:42 a.m. by kimberlyscott

Biological Motivation

Looking for the right solution to understand [How Long Does Cash App Take To Respond][1] when you apply for a Cash App refund.Usually, you will be able to get your money back within 8 to 10 working days and your refunded amount will reflect in the account wallet of your Cash App account within the least time frame.

[1]: https://www.contactmail-support.com/blog/how-long-does-cash-app-support-take-to-respond/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21