Suggested problems

How to know About McAfee My Account Login?

May 1, 2019, 3:08 a.m. by mcafee care

Biological Motivation

[McAfee My Account][1]

It has been seen that the user of McAfee account faces the issue of login. This is a common issue which anyone can come across while using the McAfee service. User can effectively solve this issue by undertaking some simple steps which are as given below:

• The problem arises when the system automatically feeds the wrong information. • In such a situation you would have to go to the Home page of McAfee and then click on the logout option if it is available. • Then you would have to take the mouse cursor over the My Account option and then click on the option to sign in. • Further on the login page if you see that your email address has been automatically displayed then delete it. • Once you have deleted the already entered email, you would have to manually enter your registered email address and password and then choose to sign in.

If you still face issues in your McAfee sign in, it would be ideal for the users to connect with the [McAfee Customer Service Number][2] In and avail their professional assistance.

[1]: https://www.mcafee.customer-carehelpline.com [2]: https://www.mcafee.customer-carehelpline.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21