Suggested problems

Can you chat with Chime to resolve tech problems?

Aug. 25, 2021, 11:57 a.m. by Kingmark

Biological Motivation

Several kinds of tech problems keep in affecting the chime system. If you are using the chime platform and willing to know [can you chat with Chime][1] then you will require following the strategic tips. Apart from that, you may prefer to explore the requirements through which you may quickly connect to the support team. Online platform for payment is considered to be the most convenient and hence people are choosing these for their financial objectives.

[1]: https://www.primotechy.com/blog/how-do-you-chat-with-chime/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21